View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7076_high_1 (Length: 503)
Name: NF7076_high_1
Description: NF7076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7076_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 20 - 247
Target Start/End: Complemental strand, 31938424 - 31938197
Alignment:
| Q |
20 |
tgtgattcagacatcaaccatgtgagactgttgtcattttagtagttactatatatctttcggtttgtttacttgtctcatccacgtgtaataatgtttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31938424 |
tgtgattcagacatcaaccatgtgagactgttgtcattttagtagttactatatatctttcggtttgtttacttgtctcatccacgtgtaataatgtttg |
31938325 |
T |
 |
| Q |
120 |
tggttaaagtagtgtttattggtctttcaggttaggctttgctcaaccagaaatgatgaaatagataactaactaaatttgtcaatttcagaccatatta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31938324 |
tggttaaagtagtgtttattggtctttcaggttaggctttgctcaaccagaaatgatgaaatagataactaactaaatttgtcaatttcagaccatatta |
31938225 |
T |
 |
| Q |
220 |
aaagtgtatcatgttcgatagattagga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31938224 |
aaagtgtatcatgttcgatagattagga |
31938197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 273 - 496
Target Start/End: Complemental strand, 31938194 - 31937971
Alignment:
| Q |
273 |
ttatagaatttatcttgaatatctggttgaacttttattgaataaaatgattgataaattgtttgctctttctatcgtggggaagttcttgtttgtggca |
372 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31938194 |
ttatagaacttatcttgaatatctggttgaacttttattgaataaaatgattgataaattgtttgctctttctattgtggggaagttcttgtttgtggca |
31938095 |
T |
 |
| Q |
373 |
tgtaatgagaggatagttgtcctattttggtcgttattcttcattggtgtatgttattttgggttttggtcatcctttatgccataaccatgtcttcttt |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31938094 |
tgtaatgagaggatagttgtcctattttggtcgttattcttcattggtgcatgttattttgggttttggtcatcctttatgccataaccatgtcttcttt |
31937995 |
T |
 |
| Q |
473 |
tattaatcgtactgatgtccatct |
496 |
Q |
| |
|
||||||||||||| ||||| |||| |
|
|
| T |
31937994 |
tattaatcgtactcatgtctatct |
31937971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University