View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7076_high_11 (Length: 276)
Name: NF7076_high_11
Description: NF7076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7076_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 8148672 - 8148459
Alignment:
| Q |
1 |
aactctccgttccgattcatctcgtctctatccaattcttcaactcattgatccttccattcattctctcggttttctctatcttctgtacgtatcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8148672 |
aactctccgttccgattcatctcgtctctatccaattcttcaactcattgatccttccattcattctctcggttttctctatcttctgtacgtatcacaa |
8148573 |
T |
 |
| Q |
101 |
taatcttattctttcttataatcgcttttttattactagattttagcttcnnnnnnngttgttgttgattgaatgtttaaaccccattcctggactctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8148572 |
taatcttattctttcttataatcgctttttaattactagattttagcttctttttttgttattgttgattgaatgtttaaaccccattcctggactctta |
8148473 |
T |
 |
| Q |
201 |
agccaaatattcac |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8148472 |
agccaaatattcac |
8148459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University