View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7076_low_13 (Length: 277)
Name: NF7076_low_13
Description: NF7076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7076_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 22 - 254
Target Start/End: Original strand, 44950432 - 44950664
Alignment:
| Q |
22 |
aggttgaaggatgaagaagtttgatttggaatcgagaaatgaaaatgaaagagattttaatttaatttgaaattagaattagggcagaggagagagaaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44950432 |
aggttgaaggatgaagaagtttgatttggaatcgagaaatgaaaatgaaagagattttaatttaatttgaaattagaattagggcagaggagagagaaaa |
44950531 |
T |
|
| Q |
122 |
gaggattggttattttatgagaaaggagtgtggcgggaggatacctgtcacacgaaggcgcgtggcagagtcatgttcattcgcttcgatcatctatctc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44950532 |
gaggattggttattttatgagaaaggagtgtggcgggaggatacctgtcacacgaaggcgcgtggcagagtcatgttcattcgcttcgatcatctatctc |
44950631 |
T |
|
| Q |
222 |
taatcacttcagcacgtgttctttgtcttttcc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44950632 |
taatcacttcagcacgtgttctttgtcttttcc |
44950664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University