View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7077_low_2 (Length: 299)
Name: NF7077_low_2
Description: NF7077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7077_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 10 - 172
Target Start/End: Complemental strand, 40255431 - 40255270
Alignment:
| Q |
10 |
ataattctgtaagatctacatataatatagtatatgtttcatatcacatttgtcaaaattaaactttttcctccattcattgatttcacgagcctaaata |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
40255431 |
ataattttgtaagatctacatataatatagtatatgtttcatatcacatttgtcaaaattaaacttttttctct-ttcattgatttcacgagcctaaata |
40255333 |
T |
 |
| Q |
110 |
ctctatctcataatttcattcagaaaattggtgatttatcataatatcaatcatacactaagt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
40255332 |
ctctatctcataatttcattcagaaaattggtgatttatcataatatcaatcatgcattaagt |
40255270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 217 - 281
Target Start/End: Complemental strand, 40254103 - 40254039
Alignment:
| Q |
217 |
ttagtaagaagttggttcatactagacaaagttgtgaattcaactactaatatcaacgtgagaaa |
281 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
40254103 |
ttagtaagaagttgattcatactagataaagatgtgaatttaactactaatatcaatgtgagaaa |
40254039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 40254345 - 40254288
Alignment:
| Q |
167 |
ctaagttactttacaaaatattaaaataaagttaacgaatattgagttaattagtaag |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||| |||| |||||||| |
|
|
| T |
40254345 |
ctaagttactttacaaaatattaaaataaagttaatgaatgttgggttagttagtaag |
40254288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University