View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7078_low_18 (Length: 230)
Name: NF7078_low_18
Description: NF7078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7078_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44625343 - 44625564
Alignment:
| Q |
1 |
tcgaaatcataacggtgccgctgctgtcaagacagaggaaaatgttgaagcagcggaaactactgctgatttagatacagaggaactggaaaaggttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44625343 |
tcgaaatcataacggtgccgctgctgtcaagacagaggaaaatgttgaagcaacggaaactactgctgatctagatacagaggaactggaaaaggttgaa |
44625442 |
T |
|
| Q |
101 |
gaagtggagtcggtgcagatggaggacaaagttgaacttcctgaagttgttgaagaagtagtggatgaagatgatgatgttgaggatgaatgggacgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625443 |
gaagtggagtcggtgcagatggaggacaaagttgaacttcctgaagttgttgaagaagtagtggatgaagatgatgatgttgaggatgaatgggacgcaa |
44625542 |
T |
|
| Q |
201 |
aaagctgggatgatgtccatct |
222 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
44625543 |
aaagctgggatgatgtcaatct |
44625564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University