View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7080_high_20 (Length: 252)
Name: NF7080_high_20
Description: NF7080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7080_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 8456485 - 8456707
Alignment:
| Q |
19 |
gttttccacagcttagtagcatttgtctggtacacccnnnnnnnctcctgtctttcactcaacttttcttaacttattgaatgtgtatagtttgcggttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8456485 |
gttttccacagcttagtagcatttgtctggtacaccctttttttctcctgtctttcactcaacttttcttaacttattgaatgtgtatagtttgtggttt |
8456584 |
T |
 |
| Q |
119 |
gtgtgctttgcaaaacatatcaaccactgaacttagctaataattgctatagactaacggctgtttggcctctgccaacaccaacgcaacaaacacgcta |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8456585 |
gtgtgctttgcaaaacatatcaaccgctgaacttagctaataattgctatagactaacggctgtttggcctctgccaacaccaacgcaacaaacacgcta |
8456684 |
T |
 |
| Q |
219 |
aatcgtcgttcttttcagtgaac |
241 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
8456685 |
aatcgtcgttctttttagtgaac |
8456707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University