View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7080_low_24 (Length: 245)
Name: NF7080_low_24
Description: NF7080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7080_low_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 45914197 - 45913975
Alignment:
| Q |
7 |
gatgaatcaggcggttgaaatgtagagaatccggatccatagtacaacataacataggatcgaatgatttaagtaggaagtgagtatagcgaagcagaag |
106 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45914197 |
gatgaatgagacggttgaaatgaagagaatccggatccgtagtacaacataacataggatcgaatga----------------gtatagcgaagcagaag |
45914114 |
T |
|
| Q |
107 |
gtagattggaaaatctgttgtaccgacatttgagtatgagttttggcggtgttctatggatatctatgactatatgcatcttcttctcttccgtttcttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45914113 |
gtagattggaaaatctgttgtaccgacatttgagtatgagttttggcggtgttctatggatatctatgactatatgcatcttcttctcttccgtttcttt |
45914014 |
T |
|
| Q |
207 |
agctttgagtgtgagtagtggatgcagtagtaaaccagc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45914013 |
agctttgagtgtgagtagtggatgcagtagtaaaccagc |
45913975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University