View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7080_low_26 (Length: 231)
Name: NF7080_low_26
Description: NF7080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7080_low_26 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 41114042 - 41113822
Alignment:
| Q |
12 |
tggtccttatgttggattggattttttctaatgcagactgcctcacacatggtgtcaaacttctcaagttggagacgttatgatgatatcagacaaaaa- |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
41114042 |
tggtccttatgttggattggattttttctaatgcagactgcctcacacatggtgtcaaacttctcaagatggagacgttatgatgataacagacaaaaaa |
41113943 |
T |
 |
| Q |
111 |
cttgcaaaggtaataaagttattattttgccacattagctgtaattttcttaaactatttttgaataacataattttgcttctggctgtcattattttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41113942 |
cttgcaaaggtaataaagttattattttgccacattagctgtaattttcttaaactatttttgaataacataattttgcttctggctgtcattattttta |
41113843 |
T |
 |
| Q |
211 |
ttgtgttgtattgctgcaggc |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41113842 |
ttgtgttgtattgctgcaggc |
41113822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 23 - 209
Target Start/End: Complemental strand, 41100215 - 41100028
Alignment:
| Q |
23 |
ttggattggatttttt-ctaatgcagactgcctcacacatggtgtcaaacttctcaagttggagacgttatgatgatatcagacaaaaacttgcaaaggt |
121 |
Q |
| |
|
|||||||||||||||| || ||| || ||||||| ||||||||| ||||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41100215 |
ttggattggatttttttcttatgtaggttgcctcaagaatggtgtcagccttctcaagatggaggcgttatgatgagatcagacaaaaacttgcaaaggt |
41100116 |
T |
 |
| Q |
122 |
aataaagttattattttgccacattagctgtaattttcttaaactatttttgaataacataattttgcttctggctgtcattattttt |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||| |||| ||||||||||||||||| | || |||||||| |||||| |
|
|
| T |
41100115 |
aataaagttattattttgctacattagctgcaattttcttaaagtattattgaataacataattttaatacttgctgtcatgattttt |
41100028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University