View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7080_low_28 (Length: 201)
Name: NF7080_low_28
Description: NF7080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7080_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 24 - 187
Target Start/End: Complemental strand, 11733782 - 11733619
Alignment:
| Q |
24 |
atttgtgttgtttcctatgaattctaccgattggaatgaattagtattgttatttagtagataaatttaaatgattatgaattgacatggatttgttatg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11733782 |
atttgtgttgtttcctatgaattctaccgattggaatgaattagtattgttatttagtaggtaaatttaaatgattatgaattgacatggatttgttatg |
11733683 |
T |
|
| Q |
124 |
atttttattgtttttgtgtggcaggatttcaagtgtgtcattcattgggaggtggcacaggttc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11733682 |
atttttattgtttttgtgtggcaggatttcaagtgtgtcattcattgggaggtggcacgggttc |
11733619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 145 - 189
Target Start/End: Complemental strand, 38178557 - 38178513
Alignment:
| Q |
145 |
caggatttcaagtgtgtcattcattgggaggtggcacaggttctg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
38178557 |
caggatttcaagtgtgtcattcattgggaggtggaactggttctg |
38178513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University