View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7080_low_4 (Length: 430)
Name: NF7080_low_4
Description: NF7080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7080_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 18 - 423
Target Start/End: Original strand, 44394486 - 44394876
Alignment:
| Q |
18 |
ctatcttaagttaacagtgaaaattattagtgaaagtgtaacgtgagccgattgatctcaaatcgatgaccaaattcaattaatacatatgtaattgcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44394486 |
ctatcttaagttaacagtgaaaattattagtgaaagtgtaacgtgagctgattgatctcaaatcaatgaccaaattcaattaatacatatgtaattgcgt |
44394585 |
T |
 |
| Q |
118 |
gttttttaatgtagcaaatccatgttatgccatgcgttattgccatgtgaaatccacttcgaccacactgatgccccgcttttttcatacaaaattgcgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44394586 |
gttttttaatgtagcaaatccatgttatgccatgcgttattgccatgtgaaatccacttcgaccacactggtgccccgcttttttcatacaaaattgcgg |
44394685 |
T |
 |
| Q |
218 |
ggaaatagagcggcaacgc--aaaagctttatgatgtagctttggaaatttcatgttcaacatccattgaaacacgagatttgacatggatccaaacata |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44394686 |
ggaaatagagcggcaacgcaaaaaagctttataatgtagctttgggaatttcatgttcaacatccattgagacacgagatttgacatggatccaaacata |
44394785 |
T |
 |
| Q |
316 |
ccgttagtgcaagtttggttttgttgtaagtttgttcaaatcatagcgtcattgtaatttcgttaaatctaacatgatatcaaacatgcacttgataaac |
415 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
44394786 |
ccgttagtgc-----------------aagtttgttcaaatcatagcgtcattgtaatttcattaaatctagcgtgatatcaaacatgcacttgataaac |
44394868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University