View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7082_high_1 (Length: 330)
Name: NF7082_high_1
Description: NF7082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7082_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 2475750 - 2475438
Alignment:
| Q |
1 |
ttggtgggggcttttatctgccggaaaggcatgannnnnnnngtaatgtatggccatctttgtcttcaccttattagctagtttaaactttccatcctta |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2475750 |
ttggtgggagcttttatctgccggaaaggcatgattttctt-gtaatgtatggccatctttgtcttcaccttattagctagtttaaactttccatcctta |
2475652 |
T |
|
| Q |
101 |
atatctttttaaataaaatttagaaacataatgcaattagttgtggcgtggttttacaagttatgccattttttcaaatcttttagctttgatttcctcg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2475651 |
atatccttttaaataaaatttagaaacataatgcaattagttgtggcgtggttttacaagttatgccattttttcaaatcttttagctttgatttcctcg |
2475552 |
T |
|
| Q |
201 |
gttggaagaatgttatgaccatttaactgttgaaccttcttatctttaagcagataatgaaatatatagccaactcttgtaatatcaaaagcgtaatctg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
2475551 |
gttggaagaatgttatgaccatttaactgttgaaccttcttatctttaagcagataatgaaatatatggccaactcttgtaatatcaaaagcgtattctg |
2475452 |
T |
|
| Q |
301 |
ctttatcttctaat |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2475451 |
ctttatcttctaat |
2475438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University