View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7082_low_10 (Length: 245)
Name: NF7082_low_10
Description: NF7082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7082_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 100 - 217
Target Start/End: Original strand, 4602311 - 4602428
Alignment:
| Q |
100 |
tattgtggaaatacattttaacatatccatttattgaagactaaaatcaaaatggagtaattattactttgatggattccagcaaattaagtaaaagctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4602311 |
tattgtggaaatacattttaacatatccatttattgaagactaaaatcaaaatggagtaattattactttgatggattccagcaaattaagtaaaagctt |
4602410 |
T |
|
| Q |
200 |
gtttggttataggttcta |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4602411 |
gtttggttataggttcta |
4602428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University