View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7083_high_8 (Length: 234)
Name: NF7083_high_8
Description: NF7083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7083_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 16 - 143
Target Start/End: Original strand, 27285304 - 27285431
Alignment:
| Q |
16 |
tgtgtcagtgttacgtgtgctagtgttgtaaatatcgagatgccaagttcaactcctaagcatcaaaaaacttgtcttggaagaaataaagtaaaaattt |
115 |
Q |
| |
|
||||||| |||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
27285304 |
tgtgtcaatgttacatgctctagtgttgtaaatatcgagatcccaagttcaactcctaagcatcaaaaaacttgtcttagaagaaaaaaaataaaaattg |
27285403 |
T |
 |
| Q |
116 |
aacacatctttgtatatagtacaattta |
143 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
27285404 |
aacatatctttgtatatagtacaattta |
27285431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University