View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7083_low_12 (Length: 215)
Name: NF7083_low_12
Description: NF7083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7083_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 6 - 205
Target Start/End: Complemental strand, 6650020 - 6649822
Alignment:
| Q |
6 |
ggtgttcgtgtatgtgtcagtgcttgcagccaatattttaaaaatcaatctggaaatcgaaccagcaagaccgattgagaggaaactccgaccgaacttc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
6650020 |
ggtgttcgtgtatgtgtcagtgcttgcagccaatattttaaaaatcaatctggaaat-gaaccagcaagaccaattgagaggaaactgcgaccaaacttc |
6649922 |
T |
 |
| Q |
106 |
tcaaataaccgaactttagataatgccggttcacggttcagttagttgagttgttcggtttggtttttaaaacattagtcgctgtgctacagcacaggtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6649921 |
tcaaataaccgaactttagataatgccggttcacggttcagttagttgagttgttcggtttggtttttaaaacattagttgctgtgctacagcacaggtt |
6649822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University