View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_high_13 (Length: 240)
Name: NF7084_high_13
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 33998216 - 33997994
Alignment:
| Q |
1 |
tgcattgaaagatttagcatcaattgcacctaaatgcttgtagggaccaatgtctctctttccaagctccatacttataccatacggatcccataactat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33998216 |
tgcattgaaagatttagcatcaattgcacctaaatgcttgtagggaccaatgtctctcttttcaagctccacacttataccatacggatcccataactat |
33998117 |
T |
|
| Q |
101 |
gttccttcaacacaaaagatttcaagttcataagggtgatgatatgttgttgccttcagaaatcagaacctgcattattcacagcactctttctcaagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33998116 |
gttccttcaacacaaaagatttcaagttcataagggtgatgatatgttgttgccttcagaaatcagaacctgcattattcacagcactctttctcaagag |
33998017 |
T |
|
| Q |
201 |
aatgcttgataatcactttatag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33998016 |
aatgcttgataatcactttatag |
33997994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 6230187 - 6230075
Alignment:
| Q |
1 |
tgcattgaaagatttagcatcaattgcacctaaatgcttgtagggaccaatgtctctctttccaagctccatacttataccatacggatcccataactat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||| |||||| |||| || || |||||||| ||||| |||| | |
|
|
| T |
6230187 |
tgcattgaaagatttagcatcaattgcacataaatgcttgtagggaccaatatccctccttccaaattccagacagatgccatacgggtcccaaaactct |
6230088 |
T |
|
| Q |
101 |
gttccttcaacac |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6230087 |
gttccttcaacac |
6230075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University