View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_high_6 (Length: 289)
Name: NF7084_high_6
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 122 - 266
Target Start/End: Original strand, 46559818 - 46559962
Alignment:
| Q |
122 |
ggtgctaattaactaggtttatgtatgtaatctccttatgaaactagtgtatcccgtgaaagatttcacgttttagagaaataaatgattaggtgtgaaa |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
46559818 |
ggtgctaattaactaggattatgtatgtaatctccttatgaaactagtgtatcccgtgaaagatttcacggtgtagagaaataaatgattaggtgtgaaa |
46559917 |
T |
|
| Q |
222 |
ttctgacacggcatttgctactaattaggattgtgttcaactacc |
266 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46559918 |
ttctgacacggcacttgctactaattaggattgtgttcaactacc |
46559962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University