View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_low_10 (Length: 255)
Name: NF7084_low_10
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 1971593 - 1971374
Alignment:
| Q |
17 |
gaatcaaggcgaaagaaggaagcgcgccgataactttgagaattgccggaatttaaatggttccggagccgattatgctgggggcgacattgaatacggc |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971593 |
gaatcaaggcgaaagaaggaagcacgccgagaactttgagaatcgccggaatttaaatgattccggagccgattatgctgggggcgacattgaatacggc |
1971494 |
T |
|
| Q |
117 |
gtcgatcagagacggttgcagcggagacaaaacaaccaaaattgatgccgccatggatgatggtgttgatacagaaggtgatggtggtgatacgggggta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| || ||||||||| |||||||||||||| |
|
|
| T |
1971493 |
gtcgatcagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacggagggtgatggttgtgatacgggggta |
1971394 |
T |
|
| Q |
217 |
ggggaagaaggtgaggaaag |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1971393 |
ggggaagaaggtgaggaaag |
1971374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 32394961 - 32394862
Alignment:
| Q |
17 |
gaatcaaggcgaaagaaggaagcgcgccgataactttgagaattgccggaatttaaatggttccggagccgattatgctgggggcgacattgaatacggc |
116 |
Q |
| |
|
||||||||||||| ||||||||| | |||| |||||||||||| ||||||||| | ||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
32394961 |
gaatcaaggcgaaggaaggaagcacaccgagaactttgagaatcgccggaattgacatgattccggagccaattatgctggtggcgacattgaatacggc |
32394862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 113 - 188
Target Start/End: Complemental strand, 19962509 - 19962434
Alignment:
| Q |
113 |
cggcgtcgatcagagacggttgcagcggagacaaaacaaccaaaattgatgccgccatggatgatggtgttgatac |
188 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
19962509 |
cggcgtcgatcagagacggttgcagtagagacaaaacgaccaaagttggtgccgccatggatgatggtggtgatac |
19962434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 195 - 236
Target Start/End: Complemental strand, 19962448 - 19962407
Alignment:
| Q |
195 |
tgatggtggtgatacgggggtaggggaagaaggtgaggaaag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19962448 |
tgatggtggtgatacgggggtaggggaagaaggtgaggaaag |
19962407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University