View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_low_11 (Length: 252)
Name: NF7084_low_11
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 233
Target Start/End: Complemental strand, 18940868 - 18940655
Alignment:
| Q |
20 |
atttgtaattaaaatatcttccatttctgacctagaattgaaatcatcctacctaaccgtcttgaaatcgcgtcactgaagtcatgcccaccatgggaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18940868 |
atttgtaattaaaatatcttccatttctgacctagaattgaaatcatcctacctaaccgtcttgaaatcgtgtcactgaagtcatgcccaccatgggaaa |
18940769 |
T |
|
| Q |
120 |
tgggttgtatcgtgatttggctcatgaaggataaatacattggtgtggcggcactacggtggagtgtaggaactgtgtgtcttcaaagccgcggagctgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18940768 |
tgggttgtatcgtgatttggctcatgaatgataaatacattggtgtggtggcactacggtggagtgtaggaactgtgtgtcttcaaagccgcggagctgt |
18940669 |
T |
|
| Q |
220 |
ggatcaaggactac |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18940668 |
ggatcaaggactac |
18940655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University