View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_low_13 (Length: 244)
Name: NF7084_low_13
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 13 - 173
Target Start/End: Complemental strand, 44062057 - 44061891
Alignment:
| Q |
13 |
atttattttctctttctaggtgaaggaaactacacgagttattatattaggaaatctatccttttacgtttagttttttcaattattatctctactcaaa |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44062057 |
atttattttctctttgtaggtgaaggaaactacacgagttataatattaggaaatctatccttttacgtttagttttttcaattattatctctactcaaa |
44061958 |
T |
|
| Q |
113 |
taaaattcgtatatatctat------atctttcagccaacattttcattcatatttatttttatttt |
173 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44061957 |
taaaattcgtctatatctatatctatatctttcagccaacattttcattcatatttatttttatttt |
44061891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University