View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_low_15 (Length: 232)
Name: NF7084_low_15
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 44062317 - 44062122
Alignment:
| Q |
18 |
agtgaaatcaatgaactgtgtaaagtcagaaacataaatatgaaaacaaaaatgtgttttgagtgaaagacaactcagaaggtggtgttattgtagctct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44062317 |
agtgaaatcaatgaactgtgtaaagtcagaaacataaatatgaaaacaaaaatgtgttttgagtgaaagacaactcagaaggtggtgttattgtagctct |
44062218 |
T |
 |
| Q |
118 |
aggggagtgtgtgaagtaaagcagactcnnnnnnncttgagaaacgataaag----gagtgagtgagtgagtacacagaaatggaatgagctcaatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44062217 |
aggggagtgtgtgaagtaaagcagactc-aaaaaacttgagaaacgataaaggagtgagtgagtgagtgagtacacagaaatggaatgagctcaatg |
44062122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University