View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7084_low_17 (Length: 217)
Name: NF7084_low_17
Description: NF7084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7084_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 41341970 - 41342181
Alignment:
| Q |
5 |
agcagaacctgtgaatttattacatctttcaacattactgtattgaaccaaccaattagttcaaagagagaaaataaaaatattaaattacagcaccaga |
104 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41341970 |
agcagcacctgtgattttattacatctttcaacattactgtattgaaccaaacaattagttcaaagagagaaaataaaaatattaaattacagcaccaga |
41342069 |
T |
|
| Q |
105 |
agatggtcccatgtaacttgctgacctcttgaattgcaggtaaaaacttcttggcaggttgaaatggaacttcattgccctgaaaattaacatcaaatat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41342070 |
agatggtcccatgtaacttgctgacctcttgaattgcaggtaaaaacttcttggcaggttgaaatggaacttcattgccctgaaaattaacatc-aatat |
41342168 |
T |
|
| Q |
205 |
caaatgctttatt |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41342169 |
caaatgctttatt |
41342181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University