View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7086_low_4 (Length: 242)
Name: NF7086_low_4
Description: NF7086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7086_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31468617 - 31468843
Alignment:
| Q |
1 |
ggatatatcaaccacatacaacttactacaattcaccaatgactttataaactccaaatctttagttgaattgcttccaagattgttttgggacaaacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31468617 |
ggatatatcaaccacatacaacttactacaattcaccaatgactttataaactccaaatctttagttgaattgcttccaagattgttttgggacaaacct |
31468716 |
T |
 |
| Q |
101 |
atgagctgaagatcttttagcttcccaagatttggaacttgacccgtgaatcggttttgagtgatatcaaatgatcgaaggttagaagcatttgatatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31468717 |
atgagctgaagatcttttagcttcccaagatttggaacttgacccgtgaatcggttttgagtgatatcaaatgatcgaaggttagaagcatttgatatgg |
31468816 |
T |
 |
| Q |
201 |
aagttgggattggacctgagaattgat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31468817 |
aagttgggattggacctgagaattgat |
31468843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 10579573 - 10579532
Alignment:
| Q |
186 |
aagcatttgatatggaagttgggattggacctgagaattgat |
227 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
10579573 |
aagcatttgcaatggaagttgggattggaccagagaattgat |
10579532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 10590070 - 10590111
Alignment:
| Q |
186 |
aagcatttgatatggaagttgggattggacctgagaattgat |
227 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
10590070 |
aagcatttgcaatggaagttgggattggaccagagaattgat |
10590111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 224
Target Start/End: Complemental strand, 10599656 - 10599616
Alignment:
| Q |
184 |
agaagcatttgatatggaagttgggattggacctgagaatt |
224 |
Q |
| |
|
|||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
10599656 |
agaagcatttgaaattgaagtagggattggacctgagaatt |
10599616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University