View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7088_high_27 (Length: 232)
Name: NF7088_high_27
Description: NF7088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7088_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 43099194 - 43099396
Alignment:
| Q |
16 |
atgaacacaaattaaaacattgaacatgcacactcc----ctaatccattgttaaatcattaacatgctacactacccaataattcccaagtaacgttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099194 |
atgaacacaaattaaaacattgaacatgcacactccacccctaatccattgttaaatcattaacatgctacactacccaataattcccaagtaacgttgt |
43099293 |
T |
 |
| Q |
112 |
taatgttggacgatggaattccaaagttcaaaggtttgcatgtaaccttcaagtgatattcactcggatgaaacaacccatccatcttaatcaaagtatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099294 |
taatgttggacgatggaattccaaagttcaaaggtttgcatgtaaccttcaagcgatattcactcggatgaaacaacccatccatcttaatcaaagtatt |
43099393 |
T |
 |
| Q |
212 |
cac |
214 |
Q |
| |
|
||| |
|
|
| T |
43099394 |
cac |
43099396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University