View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7088_high_31 (Length: 214)
Name: NF7088_high_31
Description: NF7088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7088_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 14 - 180
Target Start/End: Complemental strand, 41538952 - 41538786
Alignment:
| Q |
14 |
aacctgtgagcaaatccaataaaatgcataaccagtgaagtataatacagataattagatagaacataatccacccaacgcggagaatatgcaccaccac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41538952 |
aacctgtgagcaaatccaataaaatgcataaccagtgaagtataatacagataattagatagaacataatccacccaacgcggcgaatatgcaccaccac |
41538853 |
T |
 |
| Q |
114 |
caccacttccaatttcagacacagcattttccattttttcaccgttcattgcatcaagctccgaaaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41538852 |
caccacttccaatttcagacacagcattttccattttttcaccgttcattgcatcaagctctgaaaa |
41538786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University