View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7088_low_27 (Length: 249)
Name: NF7088_low_27
Description: NF7088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7088_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 93 - 240
Target Start/End: Complemental strand, 29146113 - 29145966
Alignment:
| Q |
93 |
agtatatacaattaattgaagattaaaagctaatacaaataaatgttaataatagtcttgtgtttaaaattaggtctagtagattaaagaccctgaggaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29146113 |
agtatatacaattaattgaagattaaaagctagtacaaataaatgttaataatagtcttgtgtttaaaattaggtctagtagattaaagaccctgaggaa |
29146014 |
T |
 |
| Q |
193 |
aacgatacacaaaacgagtctgcaattaaaggaaaagccatatattct |
240 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29146013 |
aacgatacacaagacgagtctgcaattaaaggaaaagccatatattct |
29145966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 29146169 - 29146112
Alignment:
| Q |
1 |
aaaagccagaaccaaacactccaattgaatttcttctccttttccctgcaaaaataag |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29146169 |
aaaagccagaaccaaacactccaattgaatttcttctccttttccctgcaaacataag |
29146112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University