View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7088_low_29 (Length: 237)
Name: NF7088_low_29
Description: NF7088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7088_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 53705013 - 53704777
Alignment:
| Q |
1 |
cactcgtatttgcgcttcttctcatggctggctcataattctcaatgaaacccctcagattcgtctttttaatcccttaacatgtgtcactctttttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53705013 |
cactcgtatttgcgcttcttctcatggctggctcataattctcaatgaaacccctcagattcgtctttttaatcccttaacatgtgtcactctttttctt |
53704914 |
T |
 |
| Q |
101 |
cctcctattcacactttccctaatgtggtaagctttgattattcaaatatcggtcgtgagtattcggttacaaacgatagttatttaagattttttagtt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704913 |
cctcctattcacactttccctaacgtggtaagctttgattattcaaatatcggccgtgagtattcggttacaaacgatagttatttaagattttttagtt |
53704814 |
T |
 |
| Q |
201 |
tgagacaaatgtgtgatgatttcatagctaaaattgt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704813 |
tgagacaaatgtgtgatgatttcatagctaaaattgt |
53704777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University