View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7089_high_6 (Length: 255)
Name: NF7089_high_6
Description: NF7089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7089_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 18110078 - 18109840
Alignment:
| Q |
1 |
tcatcattttgtgtcnnnnnnncaatgctttgagaagtttgaggtgaatcacttttcatgtctttggttgattcttccaaattagtagattgtggtgatg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
18110078 |
tcatcattttgtgtctttttttcaatgctttgagaagtttgaggtgaatcacttttcatgtctttagttgattcttccaaattagtagattgtggtggtg |
18109979 |
T |
|
| Q |
101 |
gaatattggtctcttgagctttttcaacctttgcttcatctaaatctttattatttgaaggacttttttctacttcttgttgaggagctacttgtgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18109978 |
gaatattggtctcttgagctttttcaacctttgcttcatctaaatctttattatttgaaggacttttttctacttcttgttgaggagctacttgtgatga |
18109879 |
T |
|
| Q |
201 |
ttgtgaaattggcttcttttgcattttaaggatgagagt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18109878 |
ttgtgaaattggcttcttttgcattttaaggatgagagt |
18109840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University