View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7089_low_6 (Length: 255)

Name: NF7089_low_6
Description: NF7089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7089_low_6
NF7089_low_6
[»] chr8 (1 HSPs)
chr8 (1-239)||(18109840-18110078)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 18110078 - 18109840
Alignment:
1 tcatcattttgtgtcnnnnnnncaatgctttgagaagtttgaggtgaatcacttttcatgtctttggttgattcttccaaattagtagattgtggtgatg 100  Q
    |||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||    
18110078 tcatcattttgtgtctttttttcaatgctttgagaagtttgaggtgaatcacttttcatgtctttagttgattcttccaaattagtagattgtggtggtg 18109979  T
101 gaatattggtctcttgagctttttcaacctttgcttcatctaaatctttattatttgaaggacttttttctacttcttgttgaggagctacttgtgatga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18109978 gaatattggtctcttgagctttttcaacctttgcttcatctaaatctttattatttgaaggacttttttctacttcttgttgaggagctacttgtgatga 18109879  T
201 ttgtgaaattggcttcttttgcattttaaggatgagagt 239  Q
    |||||||||||||||||||||||||||||||||||||||    
18109878 ttgtgaaattggcttcttttgcattttaaggatgagagt 18109840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University