View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7092_low_12 (Length: 309)

Name: NF7092_low_12
Description: NF7092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7092_low_12
NF7092_low_12
[»] chr5 (1 HSPs)
chr5 (156-290)||(8467541-8467675)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 156 - 290
Target Start/End: Original strand, 8467541 - 8467675
Alignment:
156 tttttctcctttttcggcttctcggcatcagatagtttatacgaagctttgatcttcaccagcttccctctcattgtttgattcttaagctgcaagctta 255  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||    
8467541 tttttctccttcttcggcttctcggcatcagatagtttatacgaagctttgatcttcaccagcttccctctcttggtttgattcttaagctgcaagctta 8467640  T
256 gtatcttcttgaaattcgttggaagcaccggcttg 290  Q
    |||||||||||||||| | ||| ||||||||||||    
8467641 gtatcttcttgaaatttgctgggagcaccggcttg 8467675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University