View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7092_low_12 (Length: 309)
Name: NF7092_low_12
Description: NF7092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7092_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 156 - 290
Target Start/End: Original strand, 8467541 - 8467675
Alignment:
| Q |
156 |
tttttctcctttttcggcttctcggcatcagatagtttatacgaagctttgatcttcaccagcttccctctcattgtttgattcttaagctgcaagctta |
255 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
8467541 |
tttttctccttcttcggcttctcggcatcagatagtttatacgaagctttgatcttcaccagcttccctctcttggtttgattcttaagctgcaagctta |
8467640 |
T |
 |
| Q |
256 |
gtatcttcttgaaattcgttggaagcaccggcttg |
290 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||||| |
|
|
| T |
8467641 |
gtatcttcttgaaatttgctgggagcaccggcttg |
8467675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University