View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7092_low_17 (Length: 250)
Name: NF7092_low_17
Description: NF7092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7092_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 51 - 244
Target Start/End: Complemental strand, 29170380 - 29170186
Alignment:
| Q |
51 |
ggaattcgacgttcagaatccttcattgtcgtcttggtatcggagttcgaaattgactaggccaaatcaaacggcgttggatgctcaaaccagggtttgt |
150 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
29170380 |
ggaattcgactttcggaatccttcgttgtcgtcttcgtatcggagttcgaaattgactaggccgaatcaaactgtgttggatgctcaaaccagggtttgt |
29170281 |
T |
|
| Q |
151 |
actggtccaacgcagacaaaactgcttgatgaagaacaagccttcaaggtgtttgatacaa-tcctagatcaggttcttctttctttcatctcac |
244 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
29170280 |
actggtccaacgcaaaccaaaccgcttgatgaagaacaagccttcaaggtgtttgatacaattcttagatcaggtttttctttctttcgtctcac |
29170186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University