View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7092_low_18 (Length: 246)
Name: NF7092_low_18
Description: NF7092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7092_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 37 - 246
Target Start/End: Complemental strand, 12422373 - 12422159
Alignment:
| Q |
37 |
tatttcttctttctcaacatgctagcactgtgttgttgattgcacagaaatcgcaaatgtaaaagagacataaagaaataacttctgaact-----gtaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| | || |
|
|
| T |
12422373 |
tatttcttctttctcaacatgctagcagtgtgttgttgattgcacataaatcgcaaatgtaaaagagacatgaagaaataacttctgaacttagctgaaa |
12422274 |
T |
 |
| Q |
132 |
gtggttattgttacttttcttacaagtaaactaaaagcttaataaaatctgaaaattttaatatgaggatctaccactcccttctttgcatttatgattg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12422273 |
gtggttattgttacttttcttacaagtaaactaaaagcttaataaaatctaaaaaatttaatatgaggatctaccactcccttctttgcatttatgattg |
12422174 |
T |
 |
| Q |
232 |
ttttgaactatttaa |
246 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12422173 |
ttttgaactatttaa |
12422159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University