View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7092_low_20 (Length: 227)

Name: NF7092_low_20
Description: NF7092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7092_low_20
NF7092_low_20
[»] chr1 (1 HSPs)
chr1 (143-185)||(12422054-12422096)


Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 185
Target Start/End: Original strand, 12422054 - 12422096
Alignment:
143 gtgggaagaaaatggttggcaaaggtaaataaggtggtattta 185  Q
    |||||| ||||||||||||||||||||||||||||||||||||    
12422054 gtgggatgaaaatggttggcaaaggtaaataaggtggtattta 12422096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University