View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7092_low_4 (Length: 443)

Name: NF7092_low_4
Description: NF7092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7092_low_4
NF7092_low_4
[»] chr3 (2 HSPs)
chr3 (264-417)||(45399363-45399516)
chr3 (50-175)||(45399240-45399367)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 6e-72; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 264 - 417
Target Start/End: Original strand, 45399363 - 45399516
Alignment:
264 aaatgttgcgaccttatgggtcagtttaggcagtgttgtaatacgacgacccaatttcgaacatagagcgaagaccgataattattccatacggccgtgt 363  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
45399363 aaatgttgtgaccttatgggtcagtttaggcagtgatgtaatacgacgacccaatttcgaacatagagcgaaggccgataattattccatacggccgtgt 45399462  T
364 taatgctcatgcatactactcactgccataaatgtaaccattgaaaaaatatga 417  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
45399463 taatgctcatgcatactactcaccgccataaatgtaaccattgaaaaaatatga 45399516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 50 - 175
Target Start/End: Original strand, 45399240 - 45399367
Alignment:
50 aacactaaacaaggagcaaaatagagaaggcatcaaaggaccagtgaaacaca--gatgttagatctcaaaccatgagagtaggaggcatgggcgtgcct 147  Q
    ||||||||||||||||||||||||||||||||| ||||||| |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
45399240 aacactaaacaaggagcaaaatagagaaggcataaaaggactagtgaaacacatagatgttagatctcaaaccatgagagtaggaggcatgggcgtgcct 45399339  T
148 aaacccatattagtagtgttcacaaatg 175  Q
    |||| |||||||||||||||||||||||    
45399340 aaacgcatattagtagtgttcacaaatg 45399367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University