View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7093_low_9 (Length: 243)
Name: NF7093_low_9
Description: NF7093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7093_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 243
Target Start/End: Original strand, 9996209 - 9996441
Alignment:
| Q |
11 |
gacatcaaaatagcacaattaaaaagtgagcaaccaaaattacacaattgctatattcaagactgaatatgaaattaagccttattattatgtcttcttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9996209 |
gacatcaaaatagcacaattaaaaagtgagcaaccaaaattacacaattgctatattcaagactgaatatgaaattaagccttattattatgtcttcttc |
9996308 |
T |
|
| Q |
111 |
tctcatgtaacaaaggaagaaacatttgagtttcaaatccaaaatggcgcgaaataatgacttcttgtaatgaatcaaatttaggtttagctttacacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9996309 |
tctcatgtaacaaaggaagaaacatttgagtttcaaatccaaaatggcgcgaaataatgacttcttgtaatgaatcaaatttgggtttagctttacacaa |
9996408 |
T |
|
| Q |
211 |
ccctacaaaatcgacttgtaaggcgagggatta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9996409 |
ccctacaaaatcgacttgtaaggcgagggatta |
9996441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University