View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7096_high_1 (Length: 422)
Name: NF7096_high_1
Description: NF7096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7096_high_1 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 374; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 18 - 422
Target Start/End: Original strand, 33033382 - 33033784
Alignment:
| Q |
18 |
gaactcctatatcttctctcgcaaggatgttagtacacctttactatcatagctcaaacaacttgtatgatgctgaggttaagtttgattgaaccagaaa |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033382 |
gaactcctatatcttctcttgcaaggatgttggtacacctttactatcatagctcaaacaacttgtatgatgctgaggttaagtttgattgaaccagaaa |
33033481 |
T |
 |
| Q |
118 |
tcaatcatgttatggaggagccagaacaacaatttcattgcgattagatgggaaaaaatgcgagagaaatttattgcactgagttttgatggggcggtgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33033482 |
tcaatcatgttatggaggagccagaacaacaatttcattgcgattagatgggaaaaaatgcgagagaaatttattgca--gagttttgatggggcggtgg |
33033579 |
T |
 |
| Q |
218 |
caggagagtcaagaccagcaggttgtggaggagctatacgaatctataatggtggtttccctgctgcattctcagctaaagggatacagtgaacataatc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033580 |
taggagagtcaagaccagcaggttgtggaggagctatacgaaactataatggtggtttccctgctgcattctcagctaaagggatacagtgaacataatc |
33033679 |
T |
 |
| Q |
318 |
tgcaaacattatgtttcttattttattgatagttttgtattataggtgatgaacttaggctccagtctccctagaagccaatcatattcaagtaaggtcg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33033680 |
tgcaaacattatgtttcttattttattgatagttttgtattataggtgatgaacttaggctccagtctccctagaaaccaatcatattcaagtaaggtcg |
33033779 |
T |
 |
| Q |
418 |
tatcc |
422 |
Q |
| |
|
||||| |
|
|
| T |
33033780 |
tatcc |
33033784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 314 - 415
Target Start/End: Original strand, 33033211 - 33033312
Alignment:
| Q |
314 |
aatctgcaaacattatgtttcttattttattgatagttttgtattataggtgatgaacttaggctccagtctccctagaagccaatcatattcaagtaag |
413 |
Q |
| |
|
|||||||||||||||||| | |||||| |||||||||||||| ||||||||||||||||||| ||| |||||||||||| || ||| | |||||| ||| |
|
|
| T |
33033211 |
aatctgcaaacattatgtaacctattttgttgatagttttgtactataggtgatgaacttaggttcctgtctccctagaaaccgatcctgttcaagcaag |
33033310 |
T |
 |
| Q |
414 |
gt |
415 |
Q |
| |
|
|| |
|
|
| T |
33033311 |
gt |
33033312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University