View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7098_high_4 (Length: 281)
Name: NF7098_high_4
Description: NF7098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7098_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 40931852 - 40932090
Alignment:
| Q |
18 |
gtatcaaaggtttttcatagaggaggtttgttctttatgatgcaaattcttgaatgcttccgnnnnnnnnatttgacatgtgtaaattttattgtaactg |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40931852 |
gtatcaaaggtttttcttagaggaggtttgttctttatgatgcaaattcttgaatgcttccgttttttttatttgacatgtgtaaattttattgtaactg |
40931951 |
T |
 |
| Q |
118 |
ttcctgttttgtattgcaannnnnnnnatgattgaggtttaaaatttgtgactgttcatgttttagacggcaataaatcttgttggtcagagaaacgttt |
217 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40931952 |
ttcctgttttgtattgcaattttttttatgatttaggtttaaaatttgtgactgttcatgttttagacggcaataaatcttgttggtcagagaaacgttt |
40932051 |
T |
 |
| Q |
218 |
ccatgtagtagattttctcatactgagttttgatggaat |
256 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40932052 |
ccatgtagtagattttctcacactgagttttgatggaat |
40932090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 175 - 237
Target Start/End: Original strand, 55061863 - 55061925
Alignment:
| Q |
175 |
atgttttagacggcaataaatcttgttggtcagagaaacgtttccatgtagtagattttctca |
237 |
Q |
| |
|
|||||||||| || ||||||| || ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55061863 |
atgttttagatggaaataaattttattgctcagagaaacgtttccatgtagtagattttctca |
55061925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University