View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7098_low_2 (Length: 339)
Name: NF7098_low_2
Description: NF7098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7098_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 14514349 - 14514584
Alignment:
| Q |
1 |
cgaacttttcttctttagttggcctgctccacttactcgttgaaaaaactgggcaggggcgaaatgatctcgcatgccaactcgtgaacttgctcttttt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14514349 |
cgaacttgtcttctttagttggcctgctccacttactcgttgaaaaaactgggcaggggcgaaatgatctcgcatgccaactcgtgaacttgcttctttt |
14514448 |
T |
 |
| Q |
101 |
tgtttagtttagtgggatagacaaaatttaaagcgaagcagcccgaaaaacctatcataacccaatctaat-ataaaacattaatataataaattctggt |
199 |
Q |
| |
|
| ||| ||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||| | |||||||| |||||||||||| |||| |
|
|
| T |
14514449 |
ttttttgtttagtgggatacacaaaatttaaagcgaagcggcccgaaaaacctattataacccaatctaataaaaaaacatttatataataaattttggt |
14514548 |
T |
 |
| Q |
200 |
tgattgattaattagaaaaataatcatgtgttggat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14514549 |
tgattgattaattagaaaaataatcatgtgttggat |
14514584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University