View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7098_low_8 (Length: 249)
Name: NF7098_low_8
Description: NF7098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7098_low_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 33032339 - 33032581
Alignment:
| Q |
10 |
aagaatattggaaatccgacgcaaccttgttgctcgaatctcatattatttctcacctcatga---tgaggcctaattggtgttggtgagaaaccatagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
33032339 |
aagaatattggaaatccgacgcaaccttgttgctcgaatctcatattatttctcacctcatgatgatgaggcctaattgttgttggtgagaaaccatagt |
33032438 |
T |
|
| Q |
107 |
gcattgaagagtgggcttttatccctaatgacctaaaagaaccatgcaaaggtaaagatgctaaactagcattatacctatcagaaaacattcccattct |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032439 |
gcattgaagagtgtgcttttatccctaatgacctaaaagaaccatgcaaaggtaaagatgctaaactagcattatacctatcagaaaacattcccattct |
33032538 |
T |
|
| Q |
207 |
catagctctttttgctaatgttctttctcttttatgtgcattt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032539 |
catagctctttttgctaatgttctttctcttttatgtgcattt |
33032581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University