View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7099_low_10 (Length: 253)
Name: NF7099_low_10
Description: NF7099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7099_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 53539549 - 53539754
Alignment:
| Q |
19 |
atctaagatatgacatctgttttagaagcatactcaatggaattttaaccaatccgcatgtatctcagaaaatgcttcctaacaagaggcggaaagtgca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53539549 |
atctaagatatgacatctgttttagaagcatacttaatggaattttaaccaatccgcatgtatctcagaaaatgcttcctaacaagaggcagaaagtgca |
53539648 |
T |
 |
| Q |
119 |
gagtggaatgaaccctttgtccgacattactaacggtatatgcaaaattaaactgatctatatatattgtattccatctatcatttgtttagtatggttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53539649 |
gagtggaatgaaccctttgtccgacattactaacggtatatgcaaaattaaactgatctatatatattgtattccatctatcatttgtttagtatggttc |
53539748 |
T |
 |
| Q |
219 |
agttga |
224 |
Q |
| |
|
| |||| |
|
|
| T |
53539749 |
aattga |
53539754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University