View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7099_low_6 (Length: 388)
Name: NF7099_low_6
Description: NF7099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7099_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 134 - 379
Target Start/End: Original strand, 44809514 - 44809760
Alignment:
| Q |
134 |
ctcaccaatgtcacaatgtgtgttctcttggccttattaactgagttatgagcaattataacgtatgctgaaacaagttctgtgactttgcttgattcat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44809514 |
ctcaccaatgtcacaatgtgtgttctcttggccttattaactgagttatgagcaattataatgtatgctgaaacaagttctgtgactttgcttgattcat |
44809613 |
T |
|
| Q |
234 |
tgacaggtcagtgtatgatattacttctcagaagcacatgatgttgatataagtaatatctgcttgtgcaaatttgtcttttcagttcatggnnnnnnnn |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44809614 |
tgacaggtcagtgtatgatattacttctcagaagcacatgatgttgatataagtaatatctgcttgtgcaaatttgtcttttcagttcatggtttttttt |
44809713 |
T |
|
| Q |
334 |
ag-aacagtactgcgatttggaccgcgacatcaaggttgatgatgtc |
379 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44809714 |
agaaacagtactgcgatttggaccgcgacatcaaggttgatgatgtc |
44809760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 44809399 - 44809455
Alignment:
| Q |
19 |
tgtagagtatgtgttgttagcattgttcaaccataacaataaacataaagcttataa |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44809399 |
tgtagagtatgtgttgttagcattgttcaaccataacaataaacataaagcttataa |
44809455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University