View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7100_high_9 (Length: 243)
Name: NF7100_high_9
Description: NF7100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7100_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 44 - 232
Target Start/End: Original strand, 32798069 - 32798256
Alignment:
| Q |
44 |
tgtaatgttgtgtgatgtagaaatttttgattaataacaaatatggataatttggtttcttgcaatttgggaatttgtgtttttagggcttgttgttatg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798069 |
tgtaatgttgtgtgatgtagaaatttttgattaataacaaatatggataattgggtttcttgcaatttgggaatttgtgtttttagggcttgttgttatg |
32798168 |
T |
|
| Q |
144 |
tagaagtagataatgnnnnnnnnnnnggatttggttgtgtggctatggaaaagattataattatttttgactgggttttggaatgatga |
232 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32798169 |
tagaagtagataatg-ttgtttttttggatttggttgtgtggctatggaaaagattattattatttttgactgggttttggaatgatga |
32798256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University