View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7100_low_11 (Length: 240)
Name: NF7100_low_11
Description: NF7100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7100_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 38556215 - 38556414
Alignment:
| Q |
21 |
ggagcaaccgtggatatgaagcaaccactaatagggacattgctttggtgaataaggcttgtgactttgtgaaagatgagcactctgtgccaccaaattg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556215 |
ggagcaaccgtggatatgaagcaaccactaatagggacattgctttggtgaataaggcttgtgactttgtgaaagatgagcactctgtgccaccaaattg |
38556314 |
T |
|
| Q |
121 |
gaggc-aagatttgaataggaatatggtgaagactgaagatggacgttgggtgctggctcaacgcccacaacttgctgatactcatcatgaagacattga |
219 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556315 |
gaggcaaatatttgaataggaatatggtgaagactgaagatggacgttgggtgctggctcaacgcccacaacttgctgatactcatcatgaagacattga |
38556414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 38548116 - 38548314
Alignment:
| Q |
21 |
ggagcaaccgtggatatgaagcaaccactaatagggacattgctttggtgaataaggcttgtgactttgtgaaagatgagcactctgtgccaccaaattg |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
38548116 |
ggagcaaccgtggatatgaagcaacaactgatagggacattgctttggtgaataagtcttgtgactttgtgaaagatgaacactatgtgccaccaaattg |
38548215 |
T |
|
| Q |
121 |
gaggcaagatttgaataggaatatggtgaagactgaagatggacgttgggtgctggctcaacgcccacaacttgctgatactcatcatgaagacattga |
219 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| ||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
38548216 |
gaggcaagatttgaacagaaatatggtgaagactgaagatggacgttggatgctggctcatcgcccacaagttgttgatactcatcatgaagaccttga |
38548314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University