View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7100_low_12 (Length: 226)
Name: NF7100_low_12
Description: NF7100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7100_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 111 - 192
Target Start/End: Original strand, 31832628 - 31832709
Alignment:
| Q |
111 |
ttttaatggggtgatgtgaaagagtctactgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832628 |
ttttaatggggtgatgtgaaagagtcttctgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca |
31832709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 31832518 - 31832568
Alignment:
| Q |
1 |
tcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832518 |
tcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt |
31832568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University