View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7100_low_12 (Length: 226)

Name: NF7100_low_12
Description: NF7100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7100_low_12
NF7100_low_12
[»] chr6 (2 HSPs)
chr6 (111-192)||(31832628-31832709)
chr6 (1-51)||(31832518-31832568)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 111 - 192
Target Start/End: Original strand, 31832628 - 31832709
Alignment:
111 ttttaatggggtgatgtgaaagagtctactgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca 192  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31832628 ttttaatggggtgatgtgaaagagtcttctgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca 31832709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 31832518 - 31832568
Alignment:
1 tcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
31832518 tcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt 31832568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University