View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7100_low_8 (Length: 293)
Name: NF7100_low_8
Description: NF7100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7100_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 284
Target Start/End: Complemental strand, 16414088 - 16413843
Alignment:
| Q |
20 |
gataatttggatgtaattttaagcatagtacacagttctaatgaagattaaaaattgtgattataat--ctttggactctctttaattaaatcttcacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
16414088 |
gataatttggatgtaattttaagcatagtacacagttctaatgaagattaaaaattgtgattataatgactttggactctctttaattatatcttcacat |
16413989 |
T |
|
| Q |
118 |
gtctcttagagttagtccaataaactgcaatctttccatgattgggatctttgatatgctttcaagaatttatgttctgtgtttattatgcgtgtttttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16413988 |
gtctcttagagttagtccaataaactgcaatctttccatgattgggatc---------------------tatgttctgtgtttattatgcgtgtttttt |
16413910 |
T |
|
| Q |
218 |
gccgggaaacgataaacagtatgcagcccttttgcgaaaaacgacaattggatttcaacagtattat |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16413909 |
gccgggaaacgataaacagtatgcaacccttttgcgaaaaacgacaattggatttcaacagtattat |
16413843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University