View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7102_low_13 (Length: 230)
Name: NF7102_low_13
Description: NF7102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7102_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 1543962 - 1543767
Alignment:
| Q |
20 |
gggaggaggaggaggtccactcatgtcgtggggagggtatccgccacctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543962 |
gggaggaggaggaggtccactcatgttgtggggagggtatccaccacctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttgg |
1543863 |
T |
 |
| Q |
120 |
ttgttgaaagggtatccgccaccattgttgggagggtaagcattgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543862 |
ttgttgaaagggtatccgccaccattgttgggagggtaagcattgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
1543767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 23 - 112
Target Start/End: Complemental strand, 32421730 - 32421641
Alignment:
| Q |
23 |
aggaggaggaggtccactcatgtcgtggggagggtatccgccacctgcatttggaggagcgtatccaccttgatttggaggggcatatcc |
112 |
Q |
| |
|
||||||||| ||||| ||||||| | ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32421730 |
aggaggagggggtccgctcatgttggggggagggtatccaccacctgcatttggaggagcatatccaccttgatttggaggggcgtatcc |
32421641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 161 - 215
Target Start/End: Complemental strand, 32421490 - 32421436
Alignment:
| Q |
161 |
attgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32421490 |
attgttgggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
32421436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 157
Target Start/End: Complemental strand, 32421610 - 32421524
Alignment:
| Q |
71 |
atttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttgggagggta |
157 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||| ||||||||||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32421610 |
atttggaggggagtatccagattgatttggaggggagtatccagcttgattgttaggagggtatccgccagcattgttgggagggta |
32421524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 118
Target Start/End: Complemental strand, 32421658 - 32421611
Alignment:
| Q |
71 |
atttggaggagcgtatccaccttgatttggaggggcatatccagcttg |
118 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
32421658 |
atttggaggggcgtatccgccttgatttggaggggcgtatccagcttg |
32421611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 118
Target Start/End: Complemental strand, 32425738 - 32425686
Alignment:
| Q |
66 |
cctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttg |
118 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| || ||| | ||||||||| |
|
|
| T |
32425738 |
cctgcatttggagaagcgtatccgccttgatttgcagaggcgtgtccagcttg |
32425686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University