View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7102_low_7 (Length: 336)
Name: NF7102_low_7
Description: NF7102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7102_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 5e-84; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 74 - 292
Target Start/End: Complemental strand, 44789549 - 44789326
Alignment:
| Q |
74 |
tcaaagctagtagttaaatttactaaagagtttgtcttagatctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctc-a |
172 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44789549 |
tcaaagctaatagataaatttactcaagagtttgtcttagatctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaa |
44789450 |
T |
|
| Q |
173 |
atgagcataccctcacgtttactcgttcgtatcctacct--tctcttcatcttcctctttccctg--atatattannnnnnnnagtacctaaattaattg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
44789449 |
atgagcataccctcacgtttactcgttcgtatcctacctactctcttcatcttcctctttccctgatatatattattttttttagtacctaaattaattg |
44789350 |
T |
|
| Q |
269 |
attaatttgcagaattcaggtaag |
292 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44789349 |
attaatttgcagaattcaggtaag |
44789326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 114 - 209
Target Start/End: Complemental strand, 44793056 - 44792961
Alignment:
| Q |
114 |
atctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgtatcctac |
209 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||| | |||||||||||| |||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
44793056 |
atctaaccttgcgcggcctacgattggatcgcattgaacctggtcgtgtcgtcttctcaatgaacatacctccacgtttactcgttcgtatcctac |
44792961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 114 - 203
Target Start/End: Complemental strand, 44797944 - 44797855
Alignment:
| Q |
114 |
atctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgta |
203 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||||| | |||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
44797944 |
atctaatcttgcgcgccctgcgattggatctcattgaacctggtcgtgtcgtcttctcaatgaacatacccccacgtttactcgttcgta |
44797855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 203
Target Start/End: Complemental strand, 44801334 - 44801250
Alignment:
| Q |
119 |
atcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| | |||| | |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
44801334 |
atcttgcgtggcctacgattggatctcattgagcctggccatgtcgttttctcaatgaacatacctccacgtttactcgttcgta |
44801250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 114 - 203
Target Start/End: Complemental strand, 44805831 - 44805742
Alignment:
| Q |
114 |
atctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgta |
203 |
Q |
| |
|
|||||||||||||||||||||| || ||| ||||| ||||||| |||||| | ||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
44805831 |
atctaatcttgcgtggcctacgcttcgatgtcattgagcctggccgtgtcattttcacaatgaacatacccccacgtttactcgttcgta |
44805742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University