View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7103_low_16 (Length: 230)

Name: NF7103_low_16
Description: NF7103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7103_low_16
NF7103_low_16
[»] chr7 (1 HSPs)
chr7 (113-182)||(41104762-41104831)


Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 113 - 182
Target Start/End: Original strand, 41104762 - 41104831
Alignment:
113 taaaacttgatgaataatgagcacatacatatatatagtaaaacatctcaatatatccattcattccaac 182  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
41104762 taaaacttgatgaataatgaacacatacatatatatagtaaaacatctcaatatatccattcattccaac 41104831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University