View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7104_high_4 (Length: 246)
Name: NF7104_high_4
Description: NF7104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7104_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 9993874 - 9994100
Alignment:
| Q |
1 |
atggcctagagtgtcaagagtacaagacattacacaatagtgttttcttaagtaggttttgcaatacacaacttgagtatttgtgtatgagtagaaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9993874 |
atggcctagagtgtcaagagtacaagacattacacaatagtgttttcttaagtaggttttgcaatacacaacttgagtatttgtgtatgagtacaaaaaa |
9993973 |
T |
 |
| Q |
101 |
tagtgaaaaattggataaaatttgatccagattatcaaagtggattgccccatttgtcacaataggtgttttgtttcaccaaatgtagaattattgtgtt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9993974 |
taatgaaaaattggataaaatttgatccagattatcaaagtggatttcgccatttgtcacaataggtgttttgtttcaccaaatgtagaattattgtgtt |
9994073 |
T |
 |
| Q |
201 |
taaaccatatcaaagaaaattcctcgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9994074 |
taaaccatatcaaagaaaattcctcgt |
9994100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University