View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7104_high_6 (Length: 240)
Name: NF7104_high_6
Description: NF7104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7104_high_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 9993605 - 9993827
Alignment:
| Q |
18 |
atttgttacatcaaatatttggaaatggagaatagagattggctaaaccaagccaatcaaatcaatgtttttgttgagaatctacaagattgaaagttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9993605 |
atttgttacatcaaatatttggaaatggagaatagagattggctaaaccaagccaatcaaatcaatgtttttgttgagaatctacaagattgaaagttct |
9993704 |
T |
 |
| Q |
118 |
aaacgattgggcaactattgttgttgtccaaatgcaaaataatggaagttgcctttcatgatgataattaaacccaatccttatgtgtaggctctttttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9993705 |
aaacgattgggcaactattgttgttgtccaaatgcaaaataatggaagttgcctttcatgatgataattaaacccaatccttatgtgtaggctctttttg |
9993804 |
T |
 |
| Q |
218 |
tcgtcaacattttgtttattcct |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9993805 |
tcgtcaacattttgtttattcct |
9993827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University