View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7104_high_7 (Length: 227)
Name: NF7104_high_7
Description: NF7104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7104_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 29158303 - 29158110
Alignment:
| Q |
20 |
gtttcgatcgggcatccttcatcactcaactgctttccaatggtgaagctaataccaaatccacaacaacagcatgctgtgatttctgcccttgcacaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158303 |
gtttcgatcgggcatccttcatcactcaactgctctccaatggtgaagctaataccaaatccacaacaacagcatgctgtgatttctgcccttgcacaag |
29158204 |
T |
 |
| Q |
120 |
atcaatcccacctcaatgtcagtgtactgatgttagagaaaaatgtcactcagcttgcaaaagttgcctttgcacaaggtcttttcctccacag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29158203 |
atcaatcccacctcaatgtcagtgtactgatgttaaagaaaaatgtcactcagcttgcaaaagttgcctttgcacacggtcttttcctccacag |
29158110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 32 - 213
Target Start/End: Complemental strand, 29206897 - 29206710
Alignment:
| Q |
32 |
catccttcatcactcaactgctttccaatggtgaagctaatacc------aaatccacaacaacagcatgctgtgatttctgcccttgcacaagatcaat |
125 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| | | |||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
29206897 |
catccttcatcactcaactgctctccaatggtgaagctacttacgaagtaaaatccacaacaacagcatgctgtaatagctgcccttgcacaaaatcaat |
29206798 |
T |
 |
| Q |
126 |
cccacctcaatgtcagtgtactgatgttagagaaaaatgtcactcagcttgcaaaagttgcctttgcacaaggtcttttcctccacag |
213 |
Q |
| |
|
|| ||||| ||||| ||| ||||| || |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29206797 |
tcctcctcagtgtcactgtgctgatattggagaaaaatgtcactcagcttgcaaaagatgcctttgcacaagatcttttcctccacag |
29206710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 82 - 213
Target Start/End: Complemental strand, 29145110 - 29144979
Alignment:
| Q |
82 |
acaacaacagcatgctgtgatttctgcccttgcacaagatcaatcccacctcaatgtcagtgtactgatgttagagaaaaatgtcactcagcttgcaaaa |
181 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| |||||||| || ||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
29145110 |
acaacaacagcatgctgtgattcctgcccttgcacaaaatcaatccctcctcaatgccattgtactgatattggagaaacatgtcactcagcttgcaaaa |
29145011 |
T |
 |
| Q |
182 |
gttgcctttgcacaaggtcttttcctccacag |
213 |
Q |
| |
|
| || |||||||||| ||| ||||||||||| |
|
|
| T |
29145010 |
gctgtctttgcacaaaatctattcctccacag |
29144979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University